WebCompare Fis1 Mouse qPCR Template Standard (NM_025562) from OriGene Technologies on Biocompare.com. Welcome Guest. Sign In Register. Products. Popular Categories; ... Ttc11; Primer Type Gene-specific Primers; Add to Compare List. OriGene Technologies. 9620 Medical Center Drive # 200 Rockville, Maryland 20850. WebCGI135; FIS1; hFis1; TTC 11; Immunogen. A synthesized peptide derived from human TTC11. Storage. Rabbit IgG in phosphate buffered saline , pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Store at +4°C short term. Store at -20°C long term. Avoid freeze / thaw cycle. Purification.
Anti-FIS1 antibody [GT1188] (GTX00950) GeneTex
WebPrimePCR™ PreAmp for SYBR® Green Assay: FIS1, Human Reaction: 400 reactions Gene-specific PCR ... TTC11 is a component of a mitochondrial complex that promotes mitochondrial fission (James et al. 2003 [PubMed 12783892]).[supplied by … WebFIS1 (a.k.a. CGI-135, TTC11) Cloning Information Cloning method Gibson Cloning 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG 3′ sequencing primer ATAGCGTAAAAGGAGCAACA (Common Sequencing Primers) Terms and Licenses. Academic/Nonprofit Terms. UBMTA; Institut Pasteur Label License for ... high grade bowel obstruction icd 10
FIS1 antibody (66635-1-Ig) Proteintech - ptglab
WebAnti-TTC11/FIS1 antibody (ab286127) Datasheet. SDS. Submit a review Submit a question. $670 Product size. 100 µg. Add to basket. The lead time on this item is currently 1-2 … WebMar 6, 2024 · Immunohistochemistry (Formalin/PFA-fixed paraffin-embedded sections) analysis of human kidney tissue sections labeling TTC11/FIS1 with Purified ab156865 at … WebFeb 24, 2024 · Fis1 Antibody (B-5) is an IgG 2a κ mouse monoclonal Fis1 antibody (also designated FIS-1 antibody, fission, mitochondrial 1 antibody, tetratricopeptide repeat domain 11 antibody, TTC11 antibody, or CGI-135 ORF antibody) suitable for the detection of the Fis1 protein of mouse, rat and human origin by WB, IP, IF, IHC(P) and ELISA. Fis1 … high grade cgin histology